Protocol

Ligation sequencing influenza whole genome V14 (SQK-NBD114.24 or SQK-NBD114.96) VINF_9189_v114_revF_14Jun2023

This protocol uses extracted RNA samples
Includes reverse transcription and PCR amplification using two separate primer schemes for Influenza A and Influenza B
Includes quantification and normalisation steps to ensure equal distribution of barcodes for 24, 48 and 96 samples.
Compatible with R10.4.1 flow cells

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

FOR RESEARCH USE ONLY

Overview

This protocol uses extracted RNA samples
Includes reverse transcription and PCR amplification using two separate primer schemes for Influenza A and Influenza B
Includes quantification and normalisation steps to ensure equal distribution of barcodes for 24, 48 and 96 samples.
Compatible with R10.4.1 flow cells

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

Document version: INF_9189_v114_revF_14Jun2023

1. Overview of the protocol

IMPORTANTE

Este es un producto de acceso anticipado

Para tener más información sobre los programas de acceso anticipado, consulte este artículo sobre las fases de lanzamiento del producto.

Procure usar la versión más reciente del protocolo.

Introduction to the influenza whole genome sequencing protocol

This protocol has been upgraded to our Kit 14 chemistry and describes how to carry out PCR amplification and native barcoding of influenza amplicons using the Native Barcoding Kit 24 or 96 V14 (SQK-NBD114.24 or SQK-NBD114.96). There are 96 unique barcodes available, allowing the user to pool up to 96 different Influenza A and/or Influenza B samples in one sequencing experiment.

While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the following references, that this protocol is based on.

Single-reaction genomic amplification accelerates sequencing and vaccine production for classical and Swine origin human influenza A viruses by Bin Zhou et al., 2009. and Universal influenza B virus genomic amplification facilitates sequencing, diagnostics, and reverse genetics by Bin Zhou et al., 2014.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

Ensure you have the sequencing kit, the correct equipment and third-party reagents
Download the software for acquiring and analysing your data
Check your flow cell to ensure it has enough pores for a good sequencing run

Prepare your library

You will need to:

Perform RT-PCR amplification on influenza samples
Prepare the DNA ends for adapter attachment
Ligate native barcodes supplied in the kit to the DNA ends
Ligate sequencing adapters supplied in the kit to the DNA ends
Prime the flow cell, and load your DNA library into the flow cell

Sequencing

You will need to:

Start a sequencing run using the MinKNOW software, which will collect raw data from the device and basecall the reads
Demultiplex barcoded reads in MinKNOW choosing the SQK-NBD114.24 or SQK-NBD114.96 kit option
Analyse your data using the Influenza typing workflow (wf-flu) in EPI2ME Labs.

IMPORTANTE

We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

Native Barcoding Kit 24 V14 (SQK-NBD114.24)
Native Barcoding Kit 96 V14 (SQK-NBD114.96)
R10.4.1 flow cells (FLO-MIN114)
Flow Cell Wash Kit (EXP-WSH004)
Sequencing Auxiliary Vials V14 (EXP-AUX003)
Native Barcoding Expansion V14 (EXP-NBA114)

2. Equipment and consumables

Material

Input influenza RNA
Influenza A primers
Influenza B primers
Native Barcoding Kit 24 V14 (SQK-NBD114.24) OR Native Barcoding Kit 96 V14 (SQK-NBD114.96)
SFB Expansion (EXP-SFB001)

Consumibles

SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (ThermoFisher, cat # 12574018 or 12574026)
Agua sin nucleasas (p. ej., ThermoFisher AM9937)
Agencourt AMPure XP Beads (Beckman Coulter™, A63881)
Etanol al 80 % recién preparado con agua sin nucleasas
NEB Blunt/TA Ligase Master Mix (NEB, M0367)
NEBNext Ultra II End Repair/dA-tailing Module (NEB E7546) (Módulo de reparación de extremos/Adición de dA)
NEBNext Quick Ligation Module (NEB E6056) (Módulo de ligación rápida)
Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, cat # 0030129504) with heat seals
Tubos de 1,5 ml Eppendorf DNA LoBind
2 ml Eppendorf DNA LoBind tubes
5 ml Eppendorf DNA LoBind tubes
15 ml Eppendorf DNA LoBind tubes
Reagent reservoirs for multichannel pipetting
Tubos de ensayo Qubit™ (Invitrogen Q32856)
Qubit dsDNA HS Assay Kit (ThermoFisher, cat # Q32851)
(Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)

Instrumental

Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
Magnetic rack suitable for 96 well plates, e.g. DynaMag™-96 Side Skirted Magnet (Thermo Fisher CAT#12027)
Microfuge
Mezclador vórtex
Termociclador
Mezclador Hula (mezclador giratorio suave)
Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific, 11766427)
Multichannel pipette and tips
Pipeta y puntas P1000
Pipeta y puntas P200
Pipeta y puntas P100
Pipeta y puntas P20
Pipeta y puntas P10
Pipeta y puntas P2
Cubeta con hielo
Temporizador
Fluorímetro Qubit (o equivalente para el control de calidad)

Equipo opcional

PCR hoods with UV steriliser
PCR-Cooler (Eppendorf)
Eppendorf 5424 centrifuge (or equivalent)

For this protocol, you will need your extracted Influenza RNA input in 10 mM Tris-HCl, pH 8.0.

A minimum volume of 1 µl is required per sample input of Influenza A or B.

If performing typing of an unknown sample, 2 µl of input will be required:

1 µl input for the Influenza A primer mix
1 µl for the Influenza B primer mix

Before starting

This protocol outlines how to carry out PCR amplification and native barcoding of influenza amplicons from multiple samples on a 96-well plate using the Native Barcoding Kit 24 or 96 V14 (SQK-NBD114.24 or SQK-NBD114.96).

When processing multiple samples simultaneously, we recommend making master mixes with an additional 10% of the volume. We also recommend using a template-free pre-PCR hood for making up the master mixes, and a separate template pre-PCR hood for handling the samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.

All post-PCR procedures must be carried out in a separate area to the pre-PCR preparation, with dedicated equipment for liquid handling in each area.

Reactivos de otros fabricantes

Oxford Nanopore Technologies ha probado y recomienda el uso de todos los reactivos de otros fabricantes citados en este protocolo. No se han evaluado otras alternativas.

Se recomienda preparar estos reactivos siguiendo las instrucciones del fabricante.

Influenza primer sequences

Influenza A primer sequences described in the protocol originated from: Single-reaction genomic amplification accelerates sequencing and vaccine production for classical and Swine origin human influenza A viruses by Bin Zhou et al., 2009.

Component	Sequence
Tuni 12	ACGCGTGATCAGCAAAAGCAGG
Tuni 12.4	ACGCGTGATCAGCGAAAGCAGG
Tuni 13	ACGCGTGATCAGTAGAAACAAGG

Influenza B primer sequences described in the protocol originated from: Universal influenza B virus genomic amplification facilitates sequencing, diagnostics, and reverse genetics by Bin Zhou et al., 2014.

Component	Sequence
B-PBs-UniF	GGGGGGAGCAGAAGCGGAGC
B-PBs-UniR	CCGGGTTATTAGTAGAAACACGAGC
B-PA-UniF	GGGGGGAGCAGAAGCGGTGC
B-PA-UniR	CCGGGTTATTAGTAGAAACACGTGC
B-HANA-UniF	GGGGGGAGCAGAAGCAGAGC
B-HANA-UniR	CCGGGTTATTAGTAGTAACAAGAGC
B-NP-UniF	GGGGGGAGCAGAAGCACAGC
B-NP-UniR	CCGGGTTATTAGTAGAAACAACAGC
B-M-Uni3F	GGGGGGAGCAGAAGCACGCACTT
B-Mg-Uni3F	GGGGGGAGCAGAAGCAGGCACTT
B-M-Uni3R	CCGGGTTATTAGTAGAAACAACGCACTT
B-NS-Uni3F	GGGGGGAGCAGAAGCAGAGGATT
B-NS-Uni3R	CCGGGTTATTAGTAGTAACAAGAGGATT

IMPORTANTE

Short Fragment Buffer (SFB)

Within the Native Barcoding Kit 24 V14 (SQK-NBD114.24) and Native Barcoding Kit 96 V14 (SQK-NBD114.96), Short Fragment Buffer (SFB) is supplied at the volume needed to complete the "reverse transcription, PCR and clean-up" and "adapter ligation and clean-up" steps of the protocol.

However, extra Short Fragment Buffer (SFB) is required for the "native barcode ligation" step of the protocol. This can be purchased with our SFB Expansion (EXP-SFB001).

IMPORTANTE

AMPure XP Beads

Within the Native Barcoding Kits V14 (SQK-NBD114.24 and SQK-NBD114.96), AMPure XP Beads (AXP) are supplied at the volume needed to complete the native barcoding sections of the protocol: "Native barcode ligation" and "Adapter ligation and clean-up".

However, extra AMPure XP Beads are required for the "Reverse transcription, PCR and clean-up" step of the protocol.

IMPORTANTE

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Native Barcoding Kit 24 V14 (SQK-NBD114.24) contents

Note: We are in the process of reformatting our kits with single-use tubes into a bottle format and reducing the concentration of EDTA.

Single-use tubes format with higher EDTA concentration:

Higher concentration of EDTA with a clear cap.

Bottle format with reduced EDTA concentration:

Reduced concentration of EDTA with a blue cap.

Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.

Native Barcoding Kit 96 V14 (SQK-NBD114.96) contents

Note: We are in the process of updating our kits with reduced EDTA concentration.

Higher EDTA concentration format:

Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
Native Barcode plate	NB01-96	-	3 plates	8 µl per well
DNA Control Sample	DCS	Yellow	3	35
Native Adapter	NA	Green	2	40
Sequencing Buffer	SB	Red	2	700
Library Beads	LIB	Pink	2	600
Library Solution	LIS	White cap, pink label	2	600
Elution Buffer	EB	Black	1	1,500
AMPure XP Beads	AXP	Amber	1	6,000
Long Fragment Buffer	LFB	Orange	1	7,500
Short Fragment Buffer	SFB	Clear	1	7,500
EDTA†	EDTA	Clear	1	700
Flow Cell Flush	FCF	Blue	1	15,500
Flow Cell Tether	FCT	Purple	2	200

† Higher concentration of EDTA with a clear cap.

Reduced EDTA concentration format:

Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
Native Barcode plate	NB01-96	-	3 plates	8 µl per well
DNA Control Sample	DCS	Yellow	3	35
Native Adapter	NA	Green	2	40
Sequencing Buffer	SB	Red	2	700
Library Beads	LIB	Pink	2	600
Library Solution	LIS	White cap, pink label	2	600
Elution Buffer	EB	Black	1	1,500
AMPure XP Beads	AXP	Clear cap, light teal	1	6,000
Long Fragment Buffer	LFB	Clear cap, orange label	1	7,500
Short Fragment Buffer	SFB	Clear cap, dark blue label	1	7,500
EDTA‡	EDTA	Blue	1	700
Flow Cell Flush	FCF	Clear cap, light blue label	1	15,500
Flow Cell Tether	FCT	Purple	2	200

‡ Reduced concentration of EDTA with a blue cap.

Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

The barcodes are orientated in columns in the barcode plate.

Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.

To maximise the use of the Native Barcoding Kits, the Native Barcode Auxiliary V14 (EXP-NBA114) and the Sequencing Auxiliary Vials V14 (EXP-AUX003) expansion packs are available.

These expansions provide extra library preparation and flow cell priming reagents to allow users to utilise any unused barcodes for those running in smaller subsets.

Both expansion packs used together will provide enough reagents for 12 reactions. For customers requiring extra EDTA to maximise the use of barcodes, we recommend using 0.25 M EDTA and adding 4 µl for library preps using the SQK-NBD114.24 kit and 2 µl for preps using the SQK-NBD114.96 kit.

Native Barcode Auxiliary V14 (EXP-NBA114) contents:

Note: This Product contains AMPure XP Reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Sequencing Auxiliary Vials V14 (EXP-AUX003) contents:

Native barcode sequences

Below is the full list of our native barcode (NB01-96) sequences. The first 24 unique barcodes are available in the Native Barcoding Kit 24 V14 (SQK-NBD114.24). The Native Barcoding Kit 96 V14 (SQK-NBD114.96) include the first 24 native barcodes, with the additional 72 unique barcodes. The native barcodes are shipped at 640 nM.

In addition to the barcodes, there are also flanking sequences which add an extra level of context during analysis.

Barcode flanking sequences:

Forward sequence: 5' - AAGGTTAA - barcode - CAGCACCT - 3' Reverse sequence: 5' - GGTGCTG - barcode - TTAACCTTAGCAAT - 3'

Native barcode sequences

Component	Forward sequence	Reverse sequence
NB01	CACAAAGACACCGACAACTTTCTT	AAGAAAGTTGTCGGTGTCTTTGTG
NB02	ACAGACGACTACAAACGGAATCGA	TCGATTCCGTTTGTAGTCGTCTGT
NB03	CCTGGTAACTGGGACACAAGACTC	GAGTCTTGTGTCCCAGTTACCAGG
NB04	TAGGGAAACACGATAGAATCCGAA	TTCGGATTCTATCGTGTTTCCCTA
NB05	AAGGTTACACAAACCCTGGACAAG	CTTGTCCAGGGTTTGTGTAACCTT
NB06	GACTACTTTCTGCCTTTGCGAGAA	TTCTCGCAAAGGCAGAAAGTAGTC
NB07	AAGGATTCATTCCCACGGTAACAC	GTGTTACCGTGGGAATGAATCCTT
NB08	ACGTAACTTGGTTTGTTCCCTGAA	TTCAGGGAACAAACCAAGTTACGT
NB09	AACCAAGACTCGCTGTGCCTAGTT	AACTAGGCACAGCGAGTCTTGGTT
NB10	GAGAGGACAAAGGTTTCAACGCTT	AAGCGTTGAAACCTTTGTCCTCTC
NB11	TCCATTCCCTCCGATAGATGAAAC	GTTTCATCTATCGGAGGGAATGGA
NB12	TCCGATTCTGCTTCTTTCTACCTG	CAGGTAGAAAGAAGCAGAATCGGA
NB13	AGAACGACTTCCATACTCGTGTGA	TCACACGAGTATGGAAGTCGTTCT
NB14	AACGAGTCTCTTGGGACCCATAGA	TCTATGGGTCCCAAGAGACTCGTT
NB15	AGGTCTACCTCGCTAACACCACTG	CAGTGGTGTTAGCGAGGTAGACCT
NB16	CGTCAACTGACAGTGGTTCGTACT	AGTACGAACCACTGTCAGTTGACG
NB17	ACCCTCCAGGAAAGTACCTCTGAT	ATCAGAGGTACTTTCCTGGAGGGT
NB18	CCAAACCCAACAACCTAGATAGGC	GCCTATCTAGGTTGTTGGGTTTGG
NB19	GTTCCTCGTGCAGTGTCAAGAGAT	ATCTCTTGACACTGCACGAGGAAC
NB20	TTGCGTCCTGTTACGAGAACTCAT	ATGAGTTCTCGTAACAGGACGCAA
NB21	GAGCCTCTCATTGTCCGTTCTCTA	TAGAGAACGGACAATGAGAGGCTC
NB22	ACCACTGCCATGTATCAAAGTACG	CGTACTTTGATACATGGCAGTGGT
NB23	CTTACTACCCAGTGAACCTCCTCG	CGAGGAGGTTCACTGGGTAGTAAG
NB24	GCATAGTTCTGCATGATGGGTTAG	CTAACCCATCATGCAGAACTATGC
NB25	GTAAGTTGGGTATGCAACGCAATG	CATTGCGTTGCATACCCAACTTAC
NB26	CATACAGCGACTACGCATTCTCAT	ATGAGAATGCGTAGTCGCTGTATG
NB27	CGACGGTTAGATTCACCTCTTACA	TGTAAGAGGTGAATCTAACCGTCG
NB28	TGAAACCTAAGAAGGCACCGTATC	GATACGGTGCCTTCTTAGGTTTCA
NB29	CTAGACACCTTGGGTTGACAGACC	GGTCTGTCAACCCAAGGTGTCTAG
NB30	TCAGTGAGGATCTACTTCGACCCA	TGGGTCGAAGTAGATCCTCACTGA
NB31	TGCGTACAGCAATCAGTTACATTG	CAATGTAACTGATTGCTGTACGCA
NB32	CCAGTAGAAGTCCGACAACGTCAT	ATGACGTTGTCGGACTTCTACTGG
NB33	CAGACTTGGTACGGTTGGGTAACT	AGTTACCCAACCGTACCAAGTCTG
NB34	GGACGAAGAACTCAAGTCAAAGGC	GCCTTTGACTTGAGTTCTTCGTCC
NB35	CTACTTACGAAGCTGAGGGACTGC	GCAGTCCCTCAGCTTCGTAAGTAG
NB36	ATGTCCCAGTTAGAGGAGGAAACA	TGTTTCCTCCTCTAACTGGGACAT
NB37	GCTTGCGATTGATGCTTAGTATCA	TGATACTAAGCATCAATCGCAAGC
NB38	ACCACAGGAGGACGATACAGAGAA	TTCTCTGTATCGTCCTCCTGTGGT
NB39	CCACAGTGTCAACTAGAGCCTCTC	GAGAGGCTCTAGTTGACACTGTGG
NB40	TAGTTTGGATGACCAAGGATAGCC	GGCTATCCTTGGTCATCCAAACTA
NB41	GGAGTTCGTCCAGAGAAGTACACG	CGTGTACTTCTCTGGACGAACTCC
NB42	CTACGTGTAAGGCATACCTGCCAG	CTGGCAGGTATGCCTTACACGTAG
NB43	CTTTCGTTGTTGACTCGACGGTAG	CTACCGTCGAGTCAACAACGAAAG
NB44	AGTAGAAAGGGTTCCTTCCCACTC	GAGTGGGAAGGAACCCTTTCTACT
NB45	GATCCAACAGAGATGCCTTCAGTG	CACTGAAGGCATCTCTGTTGGATC
NB46	GCTGTGTTCCACTTCATTCTCCTG	CAGGAGAATGAAGTGGAACACAGC
NB47	GTGCAACTTTCCCACAGGTAGTTC	GAACTACCTGTGGGAAAGTTGCAC
NB48	CATCTGGAACGTGGTACACCTGTA	TACAGGTGTACCACGTTCCAGATG
NB49	ACTGGTGCAGCTTTGAACATCTAG	CTAGATGTTCAAAGCTGCACCAGT
NB50	ATGGACTTTGGTAACTTCCTGCGT	ACGCAGGAAGTTACCAAAGTCCAT
NB51	GTTGAATGAGCCTACTGGGTCCTC	GAGGACCCAGTAGGCTCATTCAAC
NB52	TGAGAGACAAGATTGTTCGTGGAC	GTCCACGAACAATCTTGTCTCTCA
NB53	AGATTCAGACCGTCTCATGCAAAG	CTTTGCATGAGACGGTCTGAATCT
NB54	CAAGAGCTTTGACTAAGGAGCATG	CATGCTCCTTAGTCAAAGCTCTTG
NB55	TGGAAGATGAGACCCTGATCTACG	CGTAGATCAGGGTCTCATCTTCCA
NB56	TCACTACTCAACAGGTGGCATGAA	TTCATGCCACCTGTTGAGTAGTGA
NB57	GCTAGGTCAATCTCCTTCGGAAGT	ACTTCCGAAGGAGATTGACCTAGC
NB58	CAGGTTACTCCTCCGTGAGTCTGA	TCAGACTCACGGAGGAGTAACCTG
NB59	TCAATCAAGAAGGGAAAGCAAGGT	ACCTTGCTTTCCCTTCTTGATTGA
NB60	CATGTTCAACCAAGGCTTCTATGG	CCATAGAAGCCTTGGTTGAACATG
NB61	AGAGGGTACTATGTGCCTCAGCAC	GTGCTGAGGCACATAGTACCCTCT
NB62	CACCCACACTTACTTCAGGACGTA	TACGTCCTGAAGTAAGTGTGGGTG
NB63	TTCTGAAGTTCCTGGGTCTTGAAC	GTTCAAGACCCAGGAACTTCAGAA
NB64	GACAGACACCGTTCATCGACTTTC	GAAAGTCGATGAACGGTGTCTGTC
NB65	TTCTCAGTCTTCCTCCAGACAAGG	CCTTGTCTGGAGGAAGACTGAGAA
NB66	CCGATCCTTGTGGCTTCTAACTTC	GAAGTTAGAAGCCACAAGGATCGG
NB67	GTTTGTCATACTCGTGTGCTCACC	GGTGAGCACACGAGTATGACAAAC
NB68	GAATCTAAGCAAACACGAAGGTGG	CCACCTTCGTGTTTGCTTAGATTC
NB69	TACAGTCCGAGCCTCATGTGATCT	AGATCACATGAGGCTCGGACTGTA
NB70	ACCGAGATCCTACGAATGGAGTGT	ACACTCCATTCGTAGGATCTCGGT
NB71	CCTGGGAGCATCAGGTAGTAACAG	CTGTTACTACCTGATGCTCCCAGG
NB72	TAGCTGACTGTCTTCCATACCGAC	GTCGGTATGGAAGACAGTCAGCTA
NB73	AAGAAACAGGATGACAGAACCCTC	GAGGGTTCTGTCATCCTGTTTCTT
NB74	TACAAGCATCCCAACACTTCCACT	AGTGGAAGTGTTGGGATGCTTGTA
NB75	GACCATTGTGATGAACCCTGTTGT	ACAACAGGGTTCATCACAATGGTC
NB76	ATGCTTGTTACATCAACCCTGGAC	GTCCAGGGTTGATGTAACAAGCAT
NB77	CGACCTGTTTCTCAGGGATACAAC	GTTGTATCCCTGAGAAACAGGTCG
NB78	AACAACCGAACCTTTGAATCAGAA	TTCTGATTCAAAGGTTCGGTTGTT
NB79	TCTCGGAGATAGTTCTCACTGCTG	CAGCAGTGAGAACTATCTCCGAGA
NB80	CGGATGAACATAGGATAGCGATTC	GAATCGCTATCCTATGTTCATCCG
NB81	CCTCATCTTGTGAAGTTGTTTCGG	CCGAAACAACTTCACAAGATGAGG
NB82	ACGGTATGTCGAGTTCCAGGACTA	TAGTCCTGGAACTCGACATACCGT
NB83	TGGCTTGATCTAGGTAAGGTCGAA	TTCGACCTTACCTAGATCAAGCCA
NB84	GTAGTGGACCTAGAACCTGTGCCA	TGGCACAGGTTCTAGGTCCACTAC
NB85	AACGGAGGAGTTAGTTGGATGATC	GATCATCCAACTAACTCCTCCGTT
NB86	AGGTGATCCCAACAAGCGTAAGTA	TACTTACGCTTGTTGGGATCACCT
NB87	TACATGCTCCTGTTGTTAGGGAGG	CCTCCCTAACAACAGGAGCATGTA
NB88	TCTTCTACTACCGATCCGAAGCAG	CTGCTTCGGATCGGTAGTAGAAGA
NB89	ACAGCATCAATGTTTGGCTAGTTG	CAACTAGCCAAACATTGATGCTGT
NB90	GATGTAGAGGGTACGGTTTGAGGC	GCCTCAAACCGTACCCTCTACATC
NB91	GGCTCCATAGGAACTCACGCTACT	AGTAGCGTGAGTTCCTATGGAGCC
NB92	TTGTGAGTGGAAAGATACAGGACC	GGTCCTGTATCTTTCCACTCACAA
NB93	AGTTTCCATCACTTCAGACTTGGG	CCCAAGTCTGAAGTGATGGAAACT
NB94	GATTGTCCTCAAACTGCCACCTAC	GTAGGTGGCAGTTTGAGGACAATC
NB95	CCTGTCTGGAAGAAGAATGGACTT	AAGTCCATTCTTCTTCCAGACAGG
NB96	CTGAACGGTCATAGAGTCCACCAT	ATGGTGGACTCTATGACCGTTCAG

3. Computer requirements and software

Requisitos informáticos para el MinION Mk1B

Para secuenciar con el MinION Mk1B es necesario tener un ordenador o portátil de alto rendimiento, que pueda soportar la velocidad de adquisición de datos. Encontrará más información en el documento MinION Mk1B IT Requirements.

Requisitos informáticos para el MinION Mk1C

El MinION Mk1C contiene ordenador y pantalla integrados, lo que elimina la dependencia de cualquier accesorio para generar y analizar datos de nanoporos. Encontrará más información en el documento MinION Mk1C IT Requirements.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en los primeros tres meses desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo	Número mínimo de poros activos cubierto por la garantía
Flongle	50
MinION/GridION	800
PromethION	5000

4. Reverse transcription, PCR and clean-up

Material

Input influenza RNA
Influenza A primers
Influenza B primers

Consumibles

SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (ThermoFisher, cat # 12574018 or 12574026)
Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with heat seals
Tubos de 1,5 ml Eppendorf DNA LoBind
5 ml Eppendorf DNA LoBind tubes
15 ml Eppendorf DNA LoBind tubes
Agencourt AMPure XP beads (Beckman Coulter, A63881)
Etanol al 80 % recién preparado con agua sin nucleasas
Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
Tubos de ensayo Qubit™ (Invitrogen Q32856)

Instrumental

Termociclador
Fluorímetro Qubit (o equivalente para el control de calidad)
Multichannel pipettes suitable for dispensing 20–200 μl, and tips
P1000 pipette and tips
P200 pipette and tips
P100 pipette and tips
P20 pipette and tips
Pipeta y puntas P10
P2 pipette and tips
Magnetic rack suitable for 96 well plates, e.g. DynaMag™-96 Side Skirted Magnet (Thermo Fisher CAT#12027)
Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific, 11766427)
Microfuge

Equipo opcional

PCR hoods with UV steriliser
PCR-Cooler (Eppendorf) or ice bucket with ice

IMPORTANTE

Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation, which may affect sensitivity.

To reduce risk of contamination, we recommend the use of PCR hoods with a UV steriliser when setting up the PCR plates.

When handling the primer stocks and derivatives, use a clean template-free PCR hood.
When handling the samples and/or a positive control, use a clean template-addition PCR hood.

Note: The volume requirements can be adjusted according to stock concentrations and experiment needs.

Influenza A primer mix

Primer	Concentration	Volume
Nuclease-free water	-	378 µl
Tuni 12	100 µM	16.8 µl
Tuni 12.4	100 µM	4.2 µl
Tuni 13	100 µM	21 µl
Total		420 µl

Influenza B primer mix

Primer	Concentration	Volume
Nuclease-free water	-	378 µl
B-PBs-UniF	100 µM	5 µl
B-PBs-UniR	100 µM	5 µl
B-PA-UniF	100 µM	2.5 µl
B-PA-UniR	100 µM	2.5 µl
B-HANA-UniF	100 µM	5 µl
B-HANA-UniR	100 µM	5 µl
B-NP-UniF	100 µM	3 µl
B-NP-UniR	100 µM	3 µl
B-M-Uni3F	100 µM	1.5 µl
B-Mg-Uni3F	100 µM	1.5 µl
B-M-Uni3R	100 µM	3 µl
B-NS-Uni3F	100 µM	2.5 µl
B-NS-Uni3R	100 µM	2.5 µl
Total		420 µl

For X12 samples, use 1.5 ml Eppendorf DNA LoBind tubes:

Component	Influenza A RT-PCR Master Mix	Influenza B RT-PCR Master Mix
Nuclease free water	280 µl	280 µl
Influenza A primer mix	28 µl	-
Influenza B primer mix	-	28 µl
2X Reaction Mix	350 µl	350 µl
SuperScript™ III RT/Platinum™ Taq Mix	28 µl	28 µl
Total volume	686 µl	686 µl

For X24 samples, use 1.5 ml Eppendorf DNA LoBind tubes:

Component	Influenza A RT-PCR Master Mix	Influenza B RT-PCR Master Mix
Nuclease free water	560 µl	560 µl
Influenza A primer mix	56 µl	-
Influenza B primer mix	-	56 µl
2X Reaction Mix	700 µl	700 µl
SuperScript™ III RT/Platinum™ Taq Mix	56 µl	56 µl
Total volume	1372 µl	1372 µl

For X48 samples, use 5 ml Eppendorf DNA LoBind tubes:

Component	Influenza A RT-PCR Master Mix	Influenza B RT-PCR Master Mix
Nuclease free water	1120 µl	1120 µl
Influenza A primer mix	112 µl	-
Influenza B primer mix	-	112 µl
2X Reaction Mix	1400 µl	1400 µl
SuperScript™ III RT/Platinum™ Taq Mix	112 µl	112 µl
Total volume	2744 µl	2744 µl

For X96 samples, use 15 ml Eppendorf DNA LoBind tubes:

Component	Influenza A RT-PCR Master Mix	Influenza B RT-PCR Master Mix
Nuclease free water	2240 µl	2240 µl
Influenza A primer mix	224 µl	-
Influenza B primer mix	-	224 µl
2X Reaction Mix	2800 µl	2800 µl
SuperScript™ III RT/Platinum™ Taq Mix	224 µl	224 µl
Total volume	5488 µl	5488 µl

Note: Enusre the RT-PCR plates for each influenza type are separate:

One plate for Influenza A (Influenza A RT-PCR plate)
One plate for Influenza B (Influenza B RT-PCR plate)

IMPORTANTE

We recommend having a negative control for every plate of samples to monitor for contamination events.

Use 1 µl of nuclease-free water as your negative control input into a single well of each Influenza RT-PCR plate.

IMPORTANTE

Please note the thermal cycler programs are different for the Influenza A RT-PCR and Influenza B RT-PCR reactions.

Ensure you are using the correct program for your reaction plate.

Step	Temperature	Time	Cycles
cDNA synthesis	42°C	60 min	1
Initial denaturation	94°C	2 min	1
Denaturation Annealing and extension	94°C 45°C 68°C	30 sec 30 sec 3 min	5
Denaturation Annealing and extension	94°C 57°C 68°C	30 sec 30 sec 3 min	31
Hold	4°C	∞

Step	Temperature	Time	Cycles
cDNA synthesis	45°C	60 min	1
cDNA synthesis	55°C	30 min	1
Initial denaturation	94°C	2 min	1
Denaturation Annealing and extension	94°C 40°C 68°C	20 sec 30 sec 3 min 30 sec	5
Denaturation Annealing and extension	94°C 58°C 68°C	20 sec 30 sec 3 min 30 sec	30
Final extension	68°C	10 min	1
Hold	4°C	∞

MEDIDA OPCIONAL

If necessary, the protocol can be paused at this point. The samples should be kept at 4°C and can be stored overnight.

IMPORTANTE

From this point onwards, a clean post-PCR hood can be used if available. Decontamination with UV and or DNAzap between sample batches is recommended.

Dispose of the pelleted beads.

CHECKPOINT

Quantify 1 µl of each eluted sample using a Qubit fluorometer.

FIN DEL PROCESO

Take forward your quantified samples to the end-prep step.

However, at this point it is also possible to store the samples at 4°C overnight.

For long-term storage or to store any unused amplified material for use in later experiments, store your samples at -20°C.

5. End-prep

Consumibles

Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
NEBNext® Ultra™ II End Repair/dA-Tailing Module (E7546)
Tubos de 1,5 ml Eppendorf DNA LoBind
Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with heat seals

Instrumental

Multichannel pipette capable of dispensing 0.5 – 10 µL, and tips
P1000 pipette and tips
P200 pipette and tips
P100 pipette and tips
P20 pipette and tips
Pipeta y puntas P10
Termociclador
Microfuge
Ice bucket with ice
Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific, 11766427)
Vortex mixer

IMPORTANTE

We recommended carrying the negative control through this step until sequencing.

For optimal performance, NEB recommend the following:

Thaw all reagents on ice.
Ensure the reagents are well mixed.
Note: Do not vortex the Ultra II End Prep Enzyme Mix.
Always spin down tubes before opening for the first time each day.
The NEBNext Ultra II End Prep Reaction Buffer may contain a white precipitate. If this occurs, allow the mixture(s) to come to room temperature and pipette the buffer several times to break up the precipitate, followed by a quick vortex to mix.

Reagent	Volume per reaction	For X24 samples	For X48 samples	For X96 samples
Ultra II End-prep reaction buffer	1.75 µl	52.5 µl	105 µl	210 µl
Ultra II End-prep enzyme mix	0.75 µl	22.5 µl	45 µl	90 µl
Total	2.5 µl	75 µl	150 µl	300 µl

FIN DEL PROCESO

Take forward the end-prepped DNA into the native barcode ligation step.

If users want to pause the library preparation here, we recommend cleaning up your sample with 1X Agencourt AMPure XP beads and eluting in nuclease-free water before storing at 4°C.

6. Native barcode ligation

Material

Native Barcodes (NB01-24) OR Native Barcodes (NB01-NB96)
AMPure XP Beads (AXP) (microesferas magnéticas)
EDTA (EDTA)
Short Fragment Buffer (SFB) (tampón para fragmentos cortos)

Consumibles

Etanol al 80 % recién preparado con agua sin nucleasas
Tubos de 1,5 ml Eppendorf DNA LoBind
Agua sin nucleasas (p. ej., ThermoFisher AM9937)
NEB Blunt/TA Ligase Master Mix (NEB, M0367)

Instrumental

Magnetic rack suitable for 96-well plates
Termociclador
Mezclador Hula (mezclador giratorio suave)
Mezclador vórtex
Cubeta con hielo
Microcentrífuga
Pipeta y puntas P1000
Pipeta y puntas P100
Pipeta y puntas P10

Equipo opcional

Qubit fluorometer (or equivalent for QC check)

IMPORTANTE

To monitor cross-contamination events, we recommend that the negative control is carried through this process and a barcode is used to sequence this control.

Thaw the reagents at room temperature.
Spin down the reagent tubes for 5 seconds.
Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.

Reagent	1. Thaw at room temperature	2. Briefly spin down	3. Mix by pipetting or vortexing	4. Place on ice
EDTA (EDTA)	✓	✓	Vortexing	✓
Native Barcodes (NB01-24) or (NB01-96)	Not frozen	✓	Only pipette mix immediately before use	✓
Short Fragment Buffer (SFB)	✓	✓	Vortexing	✓

Please note: Only use one barcode per sample.

| Reagent | Volume per well for up to x24 samples | Volume per well for x25—x96 samples | | --- | --- | --- | --- | | Nuclease-free water | 6 µl | 3 µl | | End-prepped DNA
Note: Transfer to the corresponding well | 1.5 µl | 0.75 µl | | Native barcode
Note: Transfer to the corresponding well | 2.5 µl | 1.25 µl | | Blunt/TA Ligation Master Mix | 10 µl | 5 µl | | Total | 20 µl | 10 µl |

Depending on the number of samples, aliquot to each well of the columns:

Plate location	x24 samples	x48 samples	x96 samples
Columns	1-3	1-6	1-12

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

	Up to x24 samples	x25 — x96 samples
Volume of clear capped EDTA per sample	2 µl	1 µl
Volume of blue capped EDTA per sample	4 µl	2 µl

CONSEJO

EDTA is added at this step to stop the reaction.

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

	x24 samples	x48 samples	x96 samples
Total volume for preps using clear cap EDTA	~528 µl	~528 µl	~1,056 µl
Total volume for preps using blue cap EDTA	~576 µl	~576 µl	~1,152 µl

CONSEJO

We recommend checking the base of your tubes/plate are all the same volume before pooling and after to ensure all the liquid has been taken forward.

	Volume for 10 µl of sample	For 265 µl of samples	For 528 µl of samples	For 1,056 µl of samples
Volume of AXP	4 µl	106 µl	211 µl	422 µl

Note: If stuggling to obtain the necessary yield, increasing the incubation period up to 30 minutes may improve elution efficacy.

CHECKPOINT

Quantify 1 µl of eluted sample using a Qubit fluorometer.

FIN DEL PROCESO

Take forward the barcoded DNA library to the adapter ligation and clean-up step. However, at this point it is also possible to store the sample at 4°C overnight.

7. Adapter ligation and clean-up

Material

Short Fragment Buffer (SFB) (tampón para fragmentos cortos)
Elution Buffer (EB)
Native Adapter (NA)
AMPure XP Beads (AXP) (microesferas magnéticas)

Consumibles

NEBNext® Quick Ligation Module (NEB, E6056)
Tubos de 1,5 ml Eppendorf DNA LoBind
Tubos de ensayo Qubit™ (Invitrogen Q32856)
Qubit dsDNA HS Assay Kit (ThermoFisher, cat # Q32851)

Instrumental

Microcentrífuga
Gradilla magnética
Mezclador vórtex
Mezclador Hula (mezclador giratorio suave)
Termociclador
Pipeta y puntas P1000
Pipeta y puntas P200
Pipeta y puntas P100
Pipeta y puntas P20
Pipeta y puntas P10
Ice bucket with ice
Fluorímetro Qubit (o equivalente para el control de calidad)

IMPORTANTE

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Thaw the reagents at room temperature.
Spin down the reagent tubes for 5 seconds.
Ensure the reagents are fully mixed by performing 10 full volume pipette mixes. Note: Do NOT vortex the Quick T4 DNA Ligase.

The NEBNext Quick Ligation Reaction Buffer (5x) may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.

IMPORTANTE

Do not vortex the Quick T4 DNA Ligase.

Between each addition, pipette mix 10 - 20 times.

Reagent	Volume
Pooled barcoded sample	30 µl
Native Adapter (NA)	5 µl
NEBNext Quick Ligation Reaction Buffer (5X)	10 µl
Quick T4 DNA Ligase	5 µl
Total	50 µl

IMPORTANTE

The next clean-up step uses Short Fragment Buffer (SFB) and not 80% ethanol to wash the beads. The use of ethanol will be detrimental to the sequencing reaction.

Deshechar las microesferas precipitadas.

CHECKPOINT

Cuantificar 1 μl de muestra eluida utilizando un fluorímetro Qubit.

Fragment library length	Flow cell loading amount
Very short (<1 kb)	100 fmol
Short (1-10 kb)	35–50 fmol
Long (>10 kb)	300 ng

Note: If the library yields are below the input recommendations, load the entire library.

If required, we recommend using a mass to mol calculator such as the NEB calculator.

FIN DEL PROCESO

The prepared library is used for loading onto the flow cell. Store the library on ice or at 4°C until ready to load.

CONSEJO

Recomendaciones de guardado de la biblioteca

Se recomienda guardar las bibliotecas en tubos Eppendorf DNA LoBind a 4 ⁰C, durante periodos de tiempo cortos o en caso de uso repetido, por ejemplo, para recargar celdas de flujo entre lavados. Para uso individual y para conservar a largo plazo por periodos de más de 3 meses, se recomienda guardar las bibliotecas a -80 ⁰C en tubos Eppendorf DNA LoBind.

MEDIDA OPCIONAL

If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

Depending on how many flow cells the library will be split across, more Elution Buffer (EB) than what is supplied in the kit will be required.

8. Priming and loading the SpotON flow cell

Material

Flow Cell Flush (FCF) (enjuague de celda de flujo)
Flow Cell Tether (FCT) (anclaje de celda de flujo)
Library Solution (LIS)
Library Beads (LIB) (microesferas de carga de la biblioteca)
Sequencing Buffer (SB) (tampón de secuenciación)

Consumibles

Tubos de 1,5 ml Eppendorf DNA LoBind
Agua sin nucleasas (p. ej., ThermoFisher AM9937)
(Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)

Instrumental

Dispositivo MinION o GridION
SpotON Flow Cell
Pantalla protectora para celdas de flujo MinION
Pipeta y puntas P1000
Pipeta y puntas P100
Pipeta y puntas P20
Pipeta y puntas P10

IMPORTANTE

Nótese, este kit es compatible solo con las celdas de flujo R10.4.1 (FLO-MIN114).

CONSEJO

Cebado y carga de la celda de flujo

Se recomienda a los nuevos usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.

Uso de Library Solution (LIS)

En la mayoría de experimentos de secuenciación, recomendamos usar Library Beads (LIB) para cargar la biblioteca en la celda de flujo. Nótese, si previamente se ha usado agua para cargar la biblioteca, se deberá usar Library Solution (LIS) en su lugar. Nota: Algunos clientes han notado que las bibliotecas viscosas pueden cargarse con mayor facilidad cuando no se usan Library Beads (LIB).

IMPORTANTE

Para obtener un rendimiento de secuenciación óptimo y mejorar el rendimiento de las celdas de flujo MinION R10.4.1 (FLO-MIN114), recomendamos añadir seroalbúmina bovina (BSA), en una concentración total de 0,2 mg/ml, a la mezcla de cebado de la celda de flujo.

Nota: No se aconseja utilizar ningún otro tipo de albúmina (p. ej., seroalbúmina humana recombinante).

Nota: Hemos cambiando el formato de algunos de los viales de nuestros kits, de tubos monouso a botellas de mayor cantidad.

Formato en tubos monouso En el tubo de Flow Cell Flush (FCF), añadir directamente 5 µl de seroalbúmina bovina (BSA), a una concentración de 50 mg/ml y 30 µl de Flow Cell Tether (FCT).

Formato en botella: En un tubo proporcionado a la cantidad de celdas de flujo que se vayan a utilizar, mezclar los siguientes reactivos:

Reactivo	Volumen por celda de flujo
Flow Cell Flush (FCF)	1 170 µl
Bovine Serum Albumin (BSA) a una concentración de 50 mg/ml	5 µl
Flow Cell Tether (FCT)	30 µl
Volumen total	1 205 µl

MEDIDA OPCIONAL

Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.

Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.

Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

Ajustar una pipeta P1000 a 200 μl.
Introducir la punta de la pipeta en el puerto de cebado.
Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.

Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.

IMPORTANTE

Este vial contiene microesferas en suspensión. Las microesferas precipitan muy rápido; por eso, es fundamental mezclarlas justo antes de usar.

En la mayoría de experimentos de secuenciación, se recomienda usar Library Beads (LIB) . El reactivo Library Solution (LIS) está indicado para bibliotecas de ADN más viscosas.

Reactivo	Volumen por celda de flujo
Sequencing Buffer (SB)	37,5 µl
Library Beads (LIB) mezcladas justo antes de usar, o Library Solution (LIS), si se requiere	25,5 µl
Biblioteca de ADN	12 µl
Total	75 µl

Levantar suavemente la tapa del puerto de muestra SpotON.
Cargar 200 µl de mezcla de cebado en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.

IMPORTANTE

Para obtener resultados de secuenciación óptimos, instale la pantalla protectora justo después de cargar la biblioteca.

Recomendamos poner la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.
Colocar la pantalla protectora con suavidad sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y debe cubrir por completo la sección superior de la celda de flujo.

ATENCIÓN

La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipularla con cuidado.

FIN DEL PROCESO

Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.

9. Data acquisition and basecalling

Aspectos generales del análisis de datos de nanoporos

Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.

IMPORTANTE

Required settings in MinKNOW

The correct barcoding parameters must be set up on MinKNOW prior to the sequencing run. During the run setup, in the Analysis tab, enable Barcoding. Click Edit options and enable Barcode both ends and Mid-read barcodes. Optional: basecalling and/or demultiplexing of sequences can be performed using the stand-alone Guppy software.

Cómo empezar a secuenciar

El programa MinKNOW realiza el control del dispositivo de secuenciación, la adquisición de datos y la identificación de bases en tiempo real. Una vez que el usuario ha instalado MinKNOW en su ordenador, hay diferentes maneras de llevar a cabo la secuenciación:

1. Adquisición de datos e identificación de bases en tiempo real con el programa MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run".

2. Adquisición de datos e identificación de bases en tiempo real con el dispositivo GridION.

Seguir las instrucciones del manual de usuario de GridION.

3. Adquisición de datos e identificación de bases en tiempo real con el dispositivo MinION Mk1C.

Seguir las instrucciones del manual de usuario de MinION Mk1C.

4. Adquisición de datos e identificación de bases en tiempo real con el dispositivo PromethION.

Seguir las instrucciones de los manuales de usuario de PromethION o PromethION 2 Solo.

5. Adquisición de datos e identificación de bases posterior mediante MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run". Al configurar los parámetros del experimento, ajustar la pestaña Basecalling (Identificación de bases) en posición de APAGADO. Al terminar el experimento de secuenciación, seguir las instrucciones del apartado "Post-run analysis" del protocolo de MinKNOW.

10. Downstream analysis

Recommended analysis pipeline

The analysis of the FASTQ format sequence data is performed using a Nextflow workflow called Influenza Typing Workflow (wf-flu). The use of the Nextflow software has been integrated into the EPI2ME Labs software that we recommend for running our downstream analysis methods.

Alternative methods for downstream analysis are available using your device terminal or command line, however we only suggest this for experienced users.

The workflow processes the basecalled and demultiplexed DNA sequence data output generated by MinKNOW:

The sequences are filtered for a minimum length and quality thresholds (200 nucleotides and Q9 respectively) prior to sequence alignment to the CDC multi-fasta Influenza reference.
The alignment is performed using the Minimap2 software.
Depth of coverage across the mapped sequences is measured using Samtools before genetic variants are called using Medaka.
A coverage-masked consensus sequence is prepared for each sample using bcftools.
The influenza strain typing is then performed using the abricate software with an insaflu database.

The influenza strains included in the database are listed in the project documentation pages for the Influenza Typing Workflow.

The workflow returns a per-run HTML-format summary report along with a CSV file of typing results. Additional files that include mapping BAM files and VCF files of Medaka variants are also included in the workflow output.

For more information, please refer to the Influenza workflow blog.

Software set-up and installation

The EPI2ME Labs application provides a clean interface to accessing bioinformatics workflows, and is our recommended method in performing your post-sequencing analysis.

Follow the instructions in the EPI2ME Labs Installation guide to install the application on your device.

For more information on how to use EPI2ME Labs, refer to the EPI2ME Labs Quick Start guide.

Installing and updating the wf-flu workflow in EPI2ME Labs:

Ensure you have installed the wf-flu workflow prior to the first analysis set-up.

In the EPI2ME Labs home page, scroll down to the "Install workflows" section and click on epi2me-labs/wf-flu:

If you have already installed the wf-flu workflow, ensure you are using the latest version.

Updating the workflow can be done directly through EPI2ME Labs by navigating to the wf-flu workflow page and clicking Update Workflow:

Demultiplexing of multiple barcoded samples

The wf-flu analysis requires FASTQ sequence data that has already been demultiplexed.

Reads will be demultiplexed during sequencing if you are following the recommended "Required settings in MinKNOW". However, demultiplexing can also be done post-sequencing using the MinKNOW software.

For more information and guides on demultiplexing using MinKNOW, refer to the "Post-run analysis" section in our MinKNOW Protocol.

The expected input for wf-flu is a folder of folders as shown below. Each of the barcode folders should contain the FASTQ sequence data and files may either be uncompressed or gzipped.

$ tree -d FluFastq/

FluFastq/

├── barcode01

├── barcode02

├── barcode03

├── barcode04

├── barcode05

├── barcode06

└── unclassified

IMPORTANTE

Basecalling model

The basecalling model should be specified when setting up the wf-flu analysis. This should reflect the basecalling model selected during your run set-up as follows:

If using the default model, High-accuracy basecalling (HAC): r1041_e82_400bps_hac_variant_g615
If you have used Super accurate basecalling (SUP), please use: r1041_e82_400bps_sup_variant_g615
If you have used FAST basecalling, please use: r1041_e82_400bps_fast_variant_g615

Running a Flu analysis using EPI2ME Labs

Select your data input file location. Please note, this folder must contain the demultiplexed FASTQ files of your sequencing run.

Set the basecaller cgf to the basecalling model used in your sequencing run.

Expand the Extra configuration tab and set the Run name for your wf-flu analysis.

Click Launch workflow at the bottom of the page to begin your analysis.

Completed analysis and result files

The wf-flu analysis outputs will be written to the Working Directory folder specified in the EPI2ME Labs Settings tab. The location of this folder is specified in the wf-flu run Instance parameters preceeded by out_dir.

However, these files can also be accessed directly in the EPI2ME Labs application from the completed analysis page for your run:

Housekeeping and disk usage

The "Working Directory" can be specified in the EPI2ME Labs "Settings" tab and defines where the workflow intermediate files and outputs are stored.

This folder will accumulate a significant number of files that correspond to raw BAM files, other larger intermediates and analysis results files. We recommend this folder to be routinely cleared.

11. Reutilización y devoluciones de las celdas de flujo

Material

Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

Nota: Antes de proceder a su devolución, las celdas de flujo deben lavarse con agua desionizada.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

12. Issues during DNA/RNA extraction and library preparation for Kit 14

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación	Posible causa	Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2)	El método de extracción de ADN no proporciona la pureza necesaria	Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes. Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel).	El ARN se degradó durante la extracción	Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado	El ARN se degradó durante la extracción	Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling. Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación	Posible causa	Comentarios y acciones recomendadas
Escasa recuperación	Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto.	1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas. 2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación	Los fragmentos de ADN son más cortos de lo esperado	Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar.
Escasa recuperación tras la preparación de extremos	El paso de lavado utilizó etanol a <70 %	Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

13. Issues during the sequencing run for Kit 14

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación	Posible causa	Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	Se introdujo una burbuja de aire en la matriz de nanoporos	Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	La celda de flujo no está colocada correctamente	Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros	El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación	Posible causa	Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"		Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation	Possible cause	Comments and actions
Pore occupancy <40%	Not enough library was loaded on the flow cell	10–20 fmol of good quality library can be loaded on to a MinION/GridION flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0	The Native Barcoding Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FCT tube). Make sure FCT was added to FCF before priming.

Longitud de lectura más corta de lo esperado

Observación	Posible causa	Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado	Fragmentación no deseada de la muestra de ADN	La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca. 1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore. 2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado. 3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación	Posible causa	Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros) Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.	Hay contaminantes presentes en la muestra	Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones: 1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004) 2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación	Posible causa	Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible)	Se han introducido burbujas de aire en la celda de flujo	Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles	Ciertos compuestos copurificados con ADN	Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas. 1. Consulte la página Plant leaf DNA extraction method. 2. Limpiar usando el kit QIAGEN PowerClean Pro. 3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles	Hay contaminantes presentes en la muestra	Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Reduction in sequencing speed and q-score later into the run

Observation	Possible cause	Comments and actions
Reduction in sequencing speed and q-score later into the run	Fast fuel consumption is typically seen in Kit 9 chemistry (e.g. SQK-LSK109) when the flow cell is overloaded with library. Please see the appropriate protocol for your DNA library to find the recommendation.	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Fluctuación de la temperatura

Observación	Posible causa	Comentarios y acciones recomendadas
Fluctuación de la temperatura	La celda de flujo ha perdido contacto con el dispositivo	Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector están bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación	Posible causa	Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada"	El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo).	MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez acabado el tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo de secuenciación para asegurarse de que se encuentra a temperatura ambiente y con buena ventilación; a continuación, reinicie el proceso en MinKNOW. Para obtener más información sobre el control de temperatura de MinKNOW Mk 1B, consulte la sección de preguntas frecuentes, FAQ.

Device:

NCM 2024: Boston

Explore products

Documentation

Nanopore Learning

Ligation sequencing influenza whole genome V14 (SQK-NBD114.24 or SQK-NBD114.96)

Introduction to the protocol

Library preparation

Sequencing and data analysis

Troubleshooting

Document versions

Protocol

Ligation sequencing influenza whole genome V14 (SQK-NBD114.24 or SQK-NBD114.96) VINF_9189_v114_revF_14Jun2023

Contents

Introduction to the protocol

Library preparation

Sequencing and data analysis

Troubleshooting

Overview

1. Overview of the protocol

IMPORTANTE

Este es un producto de acceso anticipado

Introduction to the influenza whole genome sequencing protocol

Steps in the sequencing workflow:

Prepare for your experiment

Prepare your library

Sequencing

IMPORTANTE

We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.

IMPORTANTE

Compatibility of this protocol

2. Equipment and consumables

Material

Consumibles

Instrumental

Equipo opcional

For this protocol, you will need your extracted Influenza RNA input in 10 mM Tris-HCl, pH 8.0.

Before starting

Reactivos de otros fabricantes

Influenza primer sequences

IMPORTANTE

Short Fragment Buffer (SFB)

IMPORTANTE

AMPure XP Beads

IMPORTANTE

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Native Barcoding Kit 24 V14 (SQK-NBD114.24) contents

Native Barcoding Kit 96 V14 (SQK-NBD114.96) contents

To maximise the use of the Native Barcoding Kits, the Native Barcode Auxiliary V14 (EXP-NBA114) and the Sequencing Auxiliary Vials V14 (EXP-AUX003) expansion packs are available.

Native barcode sequences

3. Computer requirements and software

Requisitos informáticos para el MinION Mk1B

Requisitos informáticos para el MinION Mk1C

Software for nanopore sequencing

MinKNOW

EPI2ME (optional)

Verificar la celda de flujo

4. Reverse transcription, PCR and clean-up

Material

Consumibles

Instrumental

Equipo opcional

IMPORTANTE

Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation, which may affect sensitivity.

To reduce risk of contamination, we recommend the use of PCR hoods with a UV steriliser when setting up the PCR plates.

In a clean template-free pre-PCR hood, prepare the primer mixes for influenza A and influenza B as follows in 1.5 ml Eppendorf DNA LoBind tubes:

In the template-free pre-PCR hood, prepare the following master mixes in Eppendorf DNA LoBind tubes and mix thoroughly as follows:

For each influenza type, place a clean 96-well RT-PCR plate into a PCR-cooler or ice bucket with ice (if using).

Using a stepper pipette or a multichannel pipette, aliquot 49 µl of influenza A RT-PCR Master Mix into the influenza A RT-PCR plate.

Using a stepper pipette or a multichannel pipette, aliquot 49 µl of influenza B RT-PCR Master Mix into the influenza B RT-PCR plate.

IMPORTANTE

We recommend having a negative control for every plate of samples to monitor for contamination events.

Seal the RT-PCR plate(s) and transfer to a template-addition pre-PCR hood.

Transfer 1 µl of influenza A samples to the wells containing influenza A RT-PCR Master Mix in the influenza A RT-PCR plate and mix thoroughly by pipetting the contents of each well up and down.

Transfer 1 µl of influenza B samples to the wells containing influenza B RT-PCR Master Mix in the influenza B RT-PCR plate and mix thoroughly by pipetting the contents of each well up and down.

Seal the RT-PCR plate(s) and spin down in a centrifuge.

IMPORTANTE

Please note the thermal cycler programs are different for the Influenza A RT-PCR and Influenza B RT-PCR reactions.

Incubate the influenza A RT-PCR plate using the following program, with the heated lid set to 105°C:

Incubate the influenza B RT-PCR plate using the following program, with the heated lid set to 105°C:

MEDIDA OPCIONAL