Main menu

Influenza A RNA


Keller, M.W. et al., Direct RNA Sequencing of the Coding Complete Influenza A Virus Genome. Nature Scientific Reports, 8, 14408

Materials

  • 200–2000 µl MDCK cell culture or embryonated chicken egg allantoic fluid
  • TRIzol (Invitrogen)
  • Phase Lock GelTM tubes (VWR) - optional
  • RNase-free glycogen or GlycoBlue™ Coprecipitant (ThermoFisher)- optional
  • 75% freshly-prepared ethanol
  • Isopropanol
  • Nuclease-free water or TE buffer
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 1.5 ml Eppendorf tubes
  • Custom Reverse Transcription Adapter (RTA) for library prep (see below)

Methods

  1. Critical Step: Ensure you start with at least 3X more TRIzol than the volume of your starting material. Extract 250 µl of sample in a 1.5 ml Eppendorf DNA LoBind tube. For example, if you have 1000 µl starting material, four tubes will be used.

  2. Follow the standard TRIzol protocol, using a Phase Lock GelTM tube to trap the organic phase. Add 1 µg RNase-free glycogen to the first isopropanol precipitation. Then use standard 1.5 ml tubes for the pelleting steps.

  3. Optional Step: GlycoBlue Coprecipitant can be used to make the pellet visible.

  4. Critical Step: If the extractions were performed in multiple tubes, when resuspending the pellet in ethanol, use the same 1 ml of ethanol to serially resuspend all the pellets.

  5. Elute the RNA in 10–100 µl nuclease-free water or TE buffer.

Results

  • Yield: 10-1100 ng

Sequencing performance

Libraries were prepared using the Direct RNA Sequencing Kit with a custom RTA:

Name Sequence
RTA-A /5phos/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
RTA-B GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCTTTTTTTTTT
RTA-B-U12 GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCAGCAAAAGCAGG
RTA-A-U12.4 GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCAGCGAAAGCAGG

The custom RTAs can be purchased from IDT, with each of the modified RTA-B strands already duplexed to the RTA-A strand. The RTA-A has a 5’ phosphate modification for ligation. The regions of reverse complementarity between the RTA strands are underlined, and the target sequences are coloured.

  • Read length profile:

Flu RNA

Last updated: 2/19/2026

Document options

Language:

Getting started

Buy a MinION starter pack Nanopore store Sequencing service providers Channel partners

Quick links

Intellectual property Cookie policy Corporate reporting Privacy policy Terms, conditions and policies Modern slavery policy Accessibility

About Oxford Nanopore

Contact us News Media resources & contacts Investor centre Careers BSI 27001 accreditationBSI 90001 accreditationBSI mark of trust
English flag